[Home]  [Headlines]  [Latest Articles]  [Latest Comments]  [Post]  [Mail]  [Sign-in]  [Setup]  [Help]  [Register] 

"RIP SPLC: I Endured Their Wrath"

"Warmth of Collectivism Mamdani Declares ‘Historic’ Crisis After Blowing Deadline, Pushes State Bailout"

"The Political Violence Epidemic Plagues Correspondents’ Dinner"

"Virginia Dems May Have Gerrymandered Themselves Straight Into a Legal Buzzsaw - Former AG Explains It All"

"Mamdani Hopes Racial Agitation Succeeds Where ‘Affordability’ Has Failed"

"New: Iran Is Already Blatantly Violating the Ceasefire, Large Missile Barrages Reported"

"No on Virginia’s Gerrymander"

"Senate Votes to Open Debate on Landmark Voter ID Bill"

"The American Islamist Threat Never Left Us"

"Trump to Attend White House Correspondents' Dinner"

"Islamic Republic of Iran Not Dead Yet, Reportedly Using Electronic Warfare in Crucial Strait of Hormuz"

"Can Britain Be Restored?"

"Trump's Big, Beautiful Cartel Crackdown: 92 Cartel Members Extradited Before Jalisco Raid"

"Why the Left is Triggered by Western Culture"

"The Uncomfortable Truth About Trans Violence and Political Radicalization"

"AOC’s Risible Performance"

"Why the Outrage Over the Cuts at the Washington Post Is So Annoying"

"New Poll Crushes Dem, Media Narrative: Americans Demand Mass Deportations, Back ICE Overwhelmingly"

"Democratic Overreach on Immigration Beckons"

How to negotiate to buy a car

Trump warns of a 'massive Armada' headed towards Iran

End Times Prophecy: Trump Says Board of Peace Will Override Every Government & Law – 10 Kings Rising

Maine's legendary 'Lobster Lady' dies after working until she was 103 and waking up at 3am every day

Hannity Says Immigration Raids at Home Depot Are Not ‘A Good Idea’

TREASON: Their PRIVATE CHAT just got LEAKED.

"Homan Plans to Defy Spanberger After ‘Bond Villain’ Blocks ICE Cooperation in VA: ‘Not Going to Stop’"

"DemocRATZ Radical Left-Wing Vision for Virginia"

"Tim Walz Wants the Worst"

Border Patrol Agents SMASH Window and Drag Man from Car in Minnesota Chaos

"Dear White Liberals: Blacks and Hispanics Want No Part of Your Anti-ICE Protests"

"The Silliest Venezuela Take You Will Read Today"

Michael Reagan, Son of Ronald Reagan, Dies at 80

Patel: "Minnesota Fraud Probes 'Buried' Under Biden"

"There’s a Word for the West’s Appeasement of Militant Islam"

"The Bondi Beach Jihad: Sharia Supremacism and Jew Hatred, Again"

"This Is How We Win a New Cold War With China"

"How Europe Fell Behind"

"The Epstein Conspiracy in Plain Sight"

Saint Nicholas The Real St. Nick

Will Atheists in China Starve Due to No Fish to Eat?

A Thirteen State Solution for the Holy Land?

US Sends new Missle to a Pacific ally, angering China and Russia Moscow and Peoking

DeaTh noTice ... Freerepublic --- lasT Monday JR died

"‘We Are Not the Crazy Ones’: AOC Protests Too Much"

"Rep. Comer to Newsmax: No Evidence Biden Approved Autopen Use"

"Donald Trump Has Broken the Progressive Ratchet"

"America Must Slash Red Tape to Make Nuclear Power Great Again!!"

"Why the DemocRATZ Activist Class Couldn’t Celebrate the Cease-Fire They Demanded"

Antifa Calls for CIVIL WAR!

British Police Make an Arrest...of a White Child Fishing in the Thames


Status: Not Logged In; Sign In

International News
See other International News Articles

Title: Freepers Still Love war
Source: FR
URL Source: [None]
Published: May 3, 2025
Author: Vinny Barbarino
Post Date: 2025-05-03 10:19:40 by Vinny
Keywords: None
Views: 11830
Comments: 22

gleeaikin; PIF; GBA; blitz128; FtrPilot; BeauBo; USA-FRANCE; marcusmaximus; ETCM; SpeedyInTexas

🍈


To: BeauBo
Russian Telegram:

Hedgehog
Russian troops took control of more Ukrainian territory in April 2025 than in March - 175 square kilometers versus 133. Such data is provided by the Ukrainian military public Deep State. However, the calculation does not take into account territorial advances…

Just to understand the scale of the “success” - the area of ​​Moscow is 2,511 sq. km. In general, the Russian Federation is the largest country in the world by territory. Its total area is 17,125,191 sq. km. At the same time, the Russian Federation also ranks first in the world in terms of undeveloped territories - more than 15 million sq. km. We suggest considering the question of why we needed new territories in Ukraine, and at such a huge price, rhetorical.

https://t.me/moscow_laundry/274 25

The answer can be found in the strange philosophical theories of the Kremlin

15,319 posted on 05/01/2025 3:21:10 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)


To: AdmSmith

“the question of why we needed new territories in Ukraine, and at such a huge price”

Because of Putin.

A million Russian casualties. Cities destroyed. The economic prospects of a generation squandered. Individual freedom sacrificed.

All because of Putin.


15,320 posted on 05/01/2025 3:56:21 AM PDT by BeauBo


To: BeauBo

“ All because of Putin.”

The simplest answer is often the correct one.

Let’s assume he did believe that this would be a short operation and he would have his dreams realized, but since it went off the rails his SVO has taken on a new urgency. His existence.

The Soviet war against Nazi germany lasted just under 4 years. This war is now over three years and has resulted in nothing short of a disaster for Russia and the Russian people


15,321 posted on 05/01/2025 4:29:11 AM PDT by blitz128


To: BeauBo
🇩🇪 🇺🇸 Rheinmetall & Lockheed Martin are expanding cooperation to boost missile production in Europe.

They plan to build a European center of excellence for missile systems—strengthening NATO, EU defense, and reducing reliance on U.S. supply chains.

https://x.co m/NOELreports/status/1917912022890807741


15,322 posted on 05/01/2025 5:26:29 AM PDT by FtrPilot


To: PIF; ETCM
Just after the signing of the mineral deal, Trump administration approves first $50M arms sale to Ukraine through direct commercial sales (DCS).

The move signals continued U.S. support despite calls for a diplomatic solution to the conflict.

https://x.co m/NOELreports/status/1917837079448256697

Direct commercial sales must comply with ITAR...I wonder if Congress has to approve.

15,323 posted on 05/01/2025 5:53:57 AM PDT by FtrPilot


To: BeauBo
🚨 DONE DEAL: The US and Ukraine have signed a deal granting the US privileged access to Ukraine's natural resources, including aluminum, graphite, oil, and natural gas.

This agreement aims to solidify Trump's support in ceasefire talks with Russia.

https://x.co m/NOELreports/status/1917696628825244133

"...oil, and natural gas."

Bad news for ruzzia's petroleum industry.

Pipelines to Europe are already in place.

This will guarantee that Ukraine will eventually become part of the EU.

15,324 posted on 05/01/2025 6:05:42 AM PDT by FtrPilot


To: PIF
Who needs armoured personnel carriers when you have this?

https:// x.com/bayraktar_1love/status/1917583476271759462


15,325 posted on 05/01/2025 6:12:43 AM PDT by FtrPilot


To: blitz128
Russian soldier was very busy beating up his comrade and was so carried away by the process that he did not notice how he himself became a target for the drone.

https:// x.com/bayraktar_1love/status/1917666846041690219


15,326 posted on 05/01/2025 6:56:12 AM PDT by FtrPilot


To: FtrPilot

But I hear Russian GDP is waaaayyyy up 😎


15,327 posted on 05/01/2025 8:20:36 AM PDT by blitz128


To: blitz128

Covert Cabal: What Remains of the Centuries Old Omsk Arsenal (94th)

https://www.youtube.com/watch?v=iUbrWvCs3M8
6 min video


15,328 posted on 05/01/2025 9:22:03 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)


To: dummy
🍈


To: gleeaikin
Russian Offensive Campaign Assessment, April 29, 2025

Russian Security Council Secretary Dmitry Medvedev stated on April 29 that Russia's war in Ukraine must end in Russian “victory” and the “destruction” of the current Ukrainian government.[1] Senior Kremlin officials continue to signal that Russia has greater territorial ambitions than just the occupied areas of Ukraine, particularly in areas bordering the Black Sea. Russian Presidential Aide and former Security Council Secretary Nikolai Patrushev claimed in an interview with Kremlin newswire TASS published on April 29 that Ukrainian civilians, particularly those living in the Black Sea region, must “determine their own future.”[2] Patrushev specifically noted that Odesa City spent over two centuries as the Russian Empire's and Soviet Union's outpost in the Black Sea and claimed that Odesa City residents have “nothing in common” with the current Ukrainian government. These statements are a reference to Russian President Vladimir Putin's 2023 claim that Ukrainians living in the Black Sea region have nothing “to do with Ukraine” and that Odesa is a “Russian city” and follows Russian Foreign Minister Sergey Lavrov’s April 14, 2025 claim that the Ukrainian government “does not represent” residents of Odesa City and other Ukrainian territories.[3] Patrushev claimed that Russia “respects the will of the [Ukrainian] people” and attempted to justify Russia's illegal annexation of occupied Crimea, Donbas, and “Novorossiya” — an invented region in Ukraine which the Kremlin has claimed includes all of eastern and southern Ukraine and is an “integral” part of Russia.[4] Medvedev also claimed that the current Ukrainian government does not speak for the Ukrainian people.[5] Medvedev’s and Patrushev’s statements reference the longstanding Kremlin demand for regime change in Ukraine with the installation of a pro- Russian puppet government that could struggle to oppose or even support the Kremlin's goal to occupy more territory in Ukraine at a later time of the Kremlin's choosing.[6]

Senior Russian officials reiterated the longstanding, false Russian narrative that the Ukrainian government is illegitimate, likely in order to set conditions to manipulate ceasefire negotiations and renege on any future Russian-Ukrainian agreements at a time of Russia's choosing. Kremlin Spokesperson Dmitry Peskov claimed on April 29 that the “illegitimacy” of Ukrainian President Volodymyr Zelensky’s presidency would create legal difficulties in direct peace negotiations between Russia and Ukraine, but that Russia is more interested in starting negotiations and “everything else is secondary.”[7] Peskov claimed on April 24 that Russia would restart its war should “people...question the legitimacy” of Zelensky and stated that Russia has “no confidence” in the Ukrainian government.[8] Putin and other senior Russian officials have repeatedly claimed that all Ukrainian governments since 2014 are “illegitimate” and that Russia would not view any agreements concluded with the current Ukrainian government as binding.[9] Putin and other Russian officials have similarly claimed that Zelensky is illegitimate because Ukraine did not hold presidential elections in 2024, and have additionally alleged that all Ukrainian civil authorities are therefore illegitimate since the president appoints regional officials.[10] The Ukrainian Constitution explicitly prohibits elections during periods of martial law and invasion by a hostile country, however.[11] The Kremlin is deliberately coupling its purported interest in Russian-Ukrainian peace negotiations with its false narrative of Zelensky’s illegitimacy in order to set conditions for Russia to claim that any future peace settlement that Russia signs with Zelensky is illegitimate, to renege on the agreement, and relaunch the invasion at the time of Russia's choosing. Any long-term peace agreement between Russia and Ukraine must include Russia's explicit recognition of the legitimacy of the Ukrainian government and the Ukrainian Constitution.

Kremlin officials within Putin's inner circle continue to threaten NATO as Putin himself refrains from doing so — likely as part of Kremlin efforts to justify future Russian aggression against NATO to the Russian population. Medvedev claimed that the West is attempting to use a principle of “peace through force” to harm Russia, but that Russia's only possible response to this principle is “peace through fear.”[17] Medvedev claimed that other approaches do not work but that “fear still works.” Medvedev claimed that the leaders in the European Union (EU) are “Russophobic” and that Russia's relations with Europe have “passed the point of no return.”[18] Medvedev attempted to argue that allegations that Russia is trying to attack Europe are “nonsense.”[19] Patrushev claimed that parts of Europe, including France and Germany, are “flirting with the Nazis” and “deploying the military machine against Russia.”[20] Patrushev claimed that the United Kingdom (UK), the EU, and NATO leaders are threatening Russia and criticized NATO for holding large-scale exercises on its eastern flank, claiming that these exercises are practicing offensive actions against Russia. Russian President Vladimir Putin spoke on April 29 at the “Great Heritage — Common Future” forum dedicated to the 80th anniversary of the end of the Second World War and claimed that Russia must prevent the revival of Nazism and the spread of destructive ideologies, including Russophobia and national or religious intolerance. [21] Putin's statements paralleled those of Medvedev and Patrushev, but were more tempered as Putin did not criticize or threaten Europe. Kremlin officials, including those within Putin's inner circle, have recently threatened European states, including NATO member states, and are setting conditions to justify potential future Russian aggression against Europe.[22]

Putin promoted his previously proposed Eurasian security architecture on April 29 as part of Russian efforts to create an alternative Russian-led bloc that furthers Putin's goals of destroying NATO and weakening the West and its allies. Putin claimed that the world must create a new security architecture, particularly in Eurasia.[23] Putin claimed that the basis of this Eurasian security architecture could be already existing organizations, such as the Union State of Russia and Belarus, the Collective Security Treaty Organization (CSTO), the Commonwealth of Independent States (CIS), the Shanghai Cooperation Organization (SCO), BRICS, and the Association of Southeast Asian Nations (ASEAN). Patrushev similarly claimed in the April 29 TASS interview that the “Western-centric world” is no longer useful and that the popularity of BRICS and the SCO is growing.[24] Putin first proposed an alternative Eurasian and world security system in June 2024, reportedly with the support of People's Republic of China (PRC) President Xi Jinping.[25] The organizations that Putin listed as the possible foundation of his proposed Eurasian security architecture are mostly Russian- or PRC-dominated and are meant as alternatives to the United Nations (UN) or US-led alliances. Putin's renewed calls for the creation of a Eurasian security architecture notably come as Russian and North Korean officials abruptly started to publicly acknowledge their military cooperation in Russia's war in Ukraine.[26] ISW continues to assess that Russia has been building a web of overlapping coalitions and partnerships, including within the CSTO, CIS, ASEAN, BRICS, and SCO, to offset the limits of Russian state power.[27] These efforts aim to make Russia's geopolitical clout more resilient and to expand the space in which Russia can spread narratives and create perceptions.

https://www.understandingwar.org/backgrounder/russian-offensive- campaign-assessment-april-29-2025

15,302 posted on 04/29/2025 11:13:03 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)

To: PIF; BeauBo
Кремлевская табакерка

Patriarch Kirill is unhappy with the “excessive glorification” of the DPRK military. He was advised to pray for the success of the Koreans.

The head of the Church shared his dissatisfaction in a conversation with several bishops close to him. “The Patriarch believes that the SVO and, especially, the liberation of the Kursk region is a holy war, a battle for true Orthodoxy and Holy Russia. And the main Heroes of this war should be our Orthodox soldiers. It is good that the Koreans came to us and helped, without a doubt. But their excessive glorification is wrong. The real Hero of the SVO for society should be our soldier - Russian, Orthodox,” a source close to the primate in the Russian Orthodox Church told us.

According to him, Patriarch Kirill even appealed to the Ministry of Defense with an appeal “not to hide the exploits of the Russian military behind numerous news stories about the DPRK soldiers.” “The ministry responded that without the Koreans we would still be liberating the Kursk region. The patriarch said that he understands, but our guys still need to be heroized. In addition, he recalled that at first, the DPRK military committed acts of blasphemy at the front ( we wrote about one such incident, - ed.). The ministry responded that they understand everything, but praising the DPRK fighters is now the most important task. Even more important than talking about the enemy's losses,” the channel's source also reported. The Ministry of Defense confirmed the fact of the head of the Church's claims. But they admitted that they did not take them seriously, because the patriarch is not a military man. They also suggested that the head of the Russian Orthodox Church pray for the success of our North Korean friends - on the fronts of the North Military District [war in Ukraine] and other wars in which they may end up.

https://t.me/kremlin_secrets/56 00

15,303 posted on 04/29/2025 11:19:51 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)



Popov has strong support in the military.
15,304 posted on 04/30/2025 3:40:09 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)

To: FtrPilot; BeauBo; PIF
Day 1,161 of the Russian invasion. 1,100 [average is 819/day], i.e. more than 45 Russians and Norks/h. Vehicles and fuel tanks more than 345%, Motorcycles not counted yet.


15,305 posted on 04/30/2025 3:49:51 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)

In the near future, representatives of the so-called hawks in the Politburo will hold a series of closed consultations with representatives of the Russian military leadership. The main topic will be the coordination of actions in the period after the Central Military District. The Politburo is well aware of the problem of preserving military potential and human resources in the army after the war.

Dismissing about a million people with unstable psyche to their homes, depriving them of their pay, is the creation of huge social problems within the country. Therefore, in the foreseeable future, the thesis “enemies are not asleep” will be actively used by propaganda, and the army will vigilantly guard the inviolability of Russia's borders.

The plans include placing a significant part of the military not only on the western borders, but also “strengthening” the borders with the former republics of the Soviet Union. The Russian leadership has appreciated the method of US President Donald Trump “beat your own, so that strangers are afraid”, and is going to apply it in their own way. We warned you, and we will do it again. Kazakhstan is under special attention of the hawks in the Russian leadership, and during the announced consultations, the issue of the “northern territories” of this state, which were almost annexed in January 2022, will be discussed. At that time, most of the military leadership and representatives of the Security Council convinced Putin to abandon plans for Ukraine and take advantage of the crisis in Kazakhstan by seizing the northern part of this state. In the current situation, it is unlikely to come to a military invasion, but hybrid operations with threats are more than real.
https://t.me/generalsvr/3133

15,306 posted on 04/30/2025 4:04:28 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/ videos

The complete transcript.

[ Drunk Russian Soldier Charges Blind and Die ]

Today [ Apr 29, 8 pm ], there are a lot of interesting updates from the Belgorod direction. Here, trapped in a hellish grind of constant losses, poor tactics, and relentless Ukrainian drone strikes, Russian soldiers are facing one of the lowest morale crises of the war. Recently, the alcohol abuse and desperation boiled over to the point, where drunk Russian soldiers started launching Rambo- style attacks.

After Ukraine’s initial incursion, Russia rushed in thousands of reinforcements, hundreds of whom were detected en route and wiped out by Ukrainian air strikes, shattering the Russian ability to launch organized counterattacks and scattering their troops. As this is forcing Russian tactics to once again devolve into unsupported infantry assaults, Russian commanders seemingly have no other choice, as letting up the pressure for even one moment may allow Ukrainians to secure more villages in Belgorod.

To conduct their assaults, the Russian infantry units are moving through the narrow tree lines and larger forests towards the villages of Demidivka and Popivka. If we look at the topographic map, we can see that the area has a high amount of relief, with gullies and river valleys spread all over the place.

To achieve at least some cover against Ukrainian fire, Russians are trying to move through these terrain features to reach the relative safety of the settlements. Once in the settlements, Russians are much less exposed to Ukrainian fire, as the many abandoned and destroyed houses, basements, and cellars provide ample opportunities to seek shelter in.

To counter these tactics, Ukrainians are relying heavily on drone surveillance, monitoring the forest edges, and marking buildings they detect Russians moving into for subsequent FPV drone strikes. Additionally, well- equipped Ukrainian squads are deployed in and around the villages, able to quickly respond to Russian soldiers moving out in the open.

With Ukrainian drones constantly monitoring Russian ground lines of communication and past airstrikes devastating logistics hubs and bases, consistent resupply has become nearly impossible; as footage from Demidivka shows how Russian soldiers are forced to trudge around with heavy packs carrying enough supplies for a long deployment.

Geolocated combat footage shows Ukrainian FPV drone operators using coordinated double-tap strikes on buildings housing Russian troops, the first breaking down any protective barriers, while the second flies in to eliminate the forces inside.

Ukrainian drone operators also released images of the aftermath of several Russian assaults, where they attempted to move through an anti-tank ditch toward Ukrainian positions. However, they were quickly exposed and cut down by a combination of FPV drones, grenades, and machine gun fire, resulting in over a dozen bodies spread out in and around the trench.

Lastly, Ukrainians released footage of how one of many Russian soldiers decided to find refuge in alcohol amidst the demoralizing combat situation with high losses and little space to hide. However, this soldier, completely losing the will to live, left his position and exposed himself in the open on the street.

In a Rambo style, the drunken man opened non-stop fire in the general direction of Ukrainians, alerting the concealed Ukrainian soldiers nearby, and prompting them to return fire on the Russian soldier. After getting shot, the Russian soldier was able to walk a bit further before eventually collapsing and succumbing to his wounds.

Low morale and rampant alcohol abuse among Russian troops reflect both the hopelessness of the situation they are in, as well as the negligence by their commanders. Failing to adequately support their assaults and using suicidal tactics resulted in heavy losses to Ukrainian drones and small arms fire. With no clear objective and mounting casualties, many survivors are losing the will to fight. The lack of command and control only worsened the situation, as troops were thrown into senseless attacks aimed only at sustaining pressure rather than securing real gains.

Overall, the Russians continued to launch disastrous assaults, where the unsustainable nature of these attacks and the incurred high losses caused the morale of the remaining Russian soldiers to collapse.

The suicidal nature of the Russian assaults, stemming from the inability to coordinate a combined counterattack, has been the leading cause of their failure to decisively defeat the Ukrainian Belgorod incursion, resulting in tremendous losses while being unable to mount a decisive pushback.

https://www.youtube.com/watch?v=aOPYrU_5SlE

15,307 posted on 04/30/2025 6:19:44 AM PDT by PIF (They came for me and mine ... now its your turn)

To: PIF
Saudi Arabia signals it can live with lower oil prices, sources say

Lower prices are bad news for producers that rely on oil exports to fund their economies. Although producers like Saudi have a very low cost of production, they need higher oil prices to pay for government spending. When oil prices fall, many large oil- producing countries come under pressure to cut their budgets. The Saudis appear to be briefing allies and experts that they are ready to do just that.
Saudi officials in recent weeks have told allies and market participants the kingdom can live with the fall in prices by raising borrowing and cutting costs, the five sources said.
“The Saudis are ready for lower prices and may need to pull back on some major projects,” one of the sources said. All sources declined to be named due to sensitivity of the issue.

Russia, the second largest exporter in OPEC+ behind Saudi Arabia, is aware of Riyadh's plans for faster output increases, said two of the five sources who are familiar with the Russian thinking and conversations with Riyadh. Russia would prefer the group stick to slower output increases, the two sources said.

https://www.reuters.com/business/energy/saudi-arabia-signals-it- can-live-with-lower-oil-prices-sources-say-2025-04-30/

now
Brent crude oil futures 61.22
https://tradingeconomics.com/commodity/brent-crude-oil

WTI crude oil futures 58.30
https://tradingeconomics.com/commodity/crude-oil

Urals Oil 58.28
https://tradingeconomics.com/commodity/urals-oil

15,308 posted on 04/30/2025 10:32:31 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)

To: AdmSmith

Saudi Arabia alone has enough spare capacity to replace all of Russia’s current oil exports.

In the recent past (against American frackers) Saudi Arabia has bee willing to absorb extended low prices (2 years or more), to drive competitors into bankruptcy, in order to take their market share, and maximize Saudi oil income over a longer timeframe.

Now their is an opportunity for the Saudis to do this to Russia, because of the sanctions that Putin has brought onto Russia, which make the maintenance of Russia’s fields vulnerable, as happened after the Soviet collapse.

15,309 posted on 04/30/2025 3:12:52 PM PDT by BeauBo

To: AdmSmith; PIF

Ukraine Minerals Deal is signed.

MSN reports:

“The U.S. and Ukraine have signed the deal to create the United States- Ukraine Reconstruction Investment Fund — the long-awaited mineral deal that gives the U.S. rights to Ukrainian rare earth, both sides announced Wednesday.

“This agreement signals clearly to Russia that the Trump Administration is committed to a peace process centered on a free, sovereign, and prosperous Ukraine over the long term,” Treasury Secretary Scott Bessent said in a press release. “President Trump envisioned this partnership between the American people and the Ukrainian people to show both sides’ commitment to lasting peace and prosperity in Ukraine. And to be clear, no state or person who financed or supplied the Russian war machine will be allowed to benefit from the reconstruction of Ukraine.””

15,310 posted on 04/30/2025 3:29:41 PM PDT by BeauBo

To: BeauBo

“no state or person who financed or supplied the Russian war machine will be allowed to benefit from the reconstruction of Ukraine.””

I guess that means China.

15,311 posted on 05/01/2025 2:38:56 AM PDT by BeauBo

To: AdmSmith; PIF

The minerals deal is signed, and it’s a new deal for Ukraine.

Kyiv Independent reports:

“The Trump administration formally notified Congress (Under the Arms Export Control Act) on April 29 that it is preparing to authorize the sale of “$50 million or more” in “defense articles” to Ukraine.

This marks the first such move under the current U.S. government.”

15,312 posted on 05/01/2025 2:50:56 AM PDT by BeauBo

To: gleeaikin
Russian Offensive Campaign Assessment, April 30, 2025

The United States and Ukraine signed a bilateral economic partnership agreement on April 30. The US Department of the Treasury announced the agreement, which created the United States-Ukraine Reconstruction Investment Fund that aims to accelerate Ukraine's economic recovery.[1] The precise terms of the agreement are unspecified as of this publication. US Treasury Secretary Scott Bessent reiterated that the United States remains committed to peace and prosperity in a free Ukraine and noted that “no state or person who financed or supplied the Russian war machine” will be allowed to benefit from Ukraine's reconstruction.[2] Bessent also stated that the agreement signals to Russia that the Trump administration is “committed to a peace process centered on a free, sovereign, and prosperous Ukraine over the long term.” The BBC Russian Service reported that the agreement includes language that future US military aid to Ukraine could be labeled as US “investment” in Ukraine, though these details remain unconfirmed as of this report.[3]

Russian officials continue to demand full Ukrainian capitulation as the sole basis on which Russia is willing to accept a future peace agreement. Bloomberg reported on April 29, citing three sources in Moscow familiar with the matter, that Russian President Vladimir Putin rejected US Special Envoy for the Middle East Steve Witkoff’s proposal to freeze the war on the current frontlines during their April 17 meeting in Moscow and instead insisted that Russia gain all of Luhansk, Donetsk, Zaporizhia, and Kherson oblasts as part of any peace agreement.[4] Bloomberg’s report is consistent with Kremlin officials’ repeated public demands that any future peace deal must satisfy all of Russia's war goals, including the cession of all of Crimea and Luhansk, Donetsk, Zaporizhia, and Kherson oblasts to Russia.[5] Kremlin officials have continued to reiterate their refusal to make any territorial concessions even after recent reports of the US seven-point peace plan that offered Russia “de jure” US recognition of Russian sovereignty over occupied Crimea and “de facto” recognition of Russian control over the rest of occupied Ukraine — the plan that Witkoff reportedly presented to Putin on April 17.[6]

Senior Russian officials continue to demand that any end to Russia's war in Ukraine must also accomplish all of Putin's original war aims. Kremlin Spokesperson Dmitry Peskov reiterated on April 30 that Putin's main goal remains the achievement of the original goals of his full-scale invasion of Ukraine — Ukrainian demilitarization, neutrality, and regime change with the installation of a pro-Kremlin puppet government.[7] Russian Permanent Representative to the United Nations (UN) Vasily Nebenzya similarly stated on April 29 that Russia is committed to finding long-term solutions to eliminate the “root causes” of Russia's war in Ukraine.”[8] Russian officials have repeatedly defined these “root causes” as NATO's alleged violation of commitments not to expand into eastern Europe and along Russia's borders in the 1990s, 2000s, and 2010s Ukraine and the Ukrainian government's alleged discrimination against ethnic Russians and Russian language, media, and culture in Ukraine.[9] Calls for the elimination of these alleged “root causes” are in line with Putin's demands for Ukrainian regime change and neutrality as well as Putin's pre-war demand that would have required NATO to roll back to its pre-1997 borders.[10]

Russian officials continue to set conditions to manipulate any future ceasefires and renege on any future Russian-Ukrainian agreements at a time of Russia's choosing. Peskov claimed that Russia must conclude a peace agreement with Ukraine rather than with the United States, and Nebenzya claimed that Russia is willing to hold direct talks with Ukrainian officials “without preconditions” despite alleged issues with Ukrainian President Volodymyr Zelensky’s legitimacy.[11] Putin and other Russian officials have similarly claimed that the current Ukrainian government is illegitimate because Ukraine did not hold presidential elections in 2024 (in accordance with its constitution and law).[12] ISW continues to assess that the Kremlin is setting conditions to renege on any future agreement it signs with Ukraine on the grounds that the Ukrainian government was not legitimate.[13] Any long-term peace agreement between Russia and Ukraine must include Russia's explicit recognition of the legitimacy of the Ukrainian government and the Ukrainian Constitution. These intransigent Russian demands run contrary to both the US-proposed seven-point peace plan and US President Donald Trump's stated goal of ensuring a lasting peace in Ukraine.[14]

North Korea and Russia continue to enhance bilateral cooperation, particularly in the military and labor spheres. Reuters reported on April 30, citing South Korean intelligence, that roughly 600 North Korean troops have died in Russia out of a total deployment of 15,000 since November 2024 and that North Korean forces have suffered approximately 4,700 casualties in Russia's war against Ukraine to date. [39] Reuters also noted that North Korean battlefield experience in Russia's Kursk Oblast over the past six months has improved North Koreans’ combat capabilities, particularly in drone usage, and that Russia has provided North Korea with technical assistance on spy satellites, drones, and anti-air missiles in return for its military support. Reuters also reported that South Korean intelligence suggests that North Korea has sent approximately 15,000 workers to Russia, in violation of United Nations (UN) sanctions that prohibit the export of North Korean labor to third countries. US State Department Spokesperson Tammy Bruce stated on April 29 that North Korea is derailing efforts to achieve peace between Russia and Ukraine and that Russia's military assistance and training of North Korean troops directly violates the UN Security Council Resolutions 1718, 1874, and 2270, all of which broadly prohibit North Korea from receiving or providing military training or assistance to other countries.[40] Russian Prime Minister Mikhail Mishustin stated on April 30 that Russia and North Korea are constructing a bridge to enhance bilateral relations.[41] Russian opposition outlet Meduza added that Russia and North Korea will complete its construction in 1.5 years (approximately in late 2026) and that the bridge will support vehicle traffic between the two countries.[42] Russia and North Korea will likely use the bridge for materiel transportation as the two states strengthen their cooperation.

https://www.understandingwar.org/backgrounder/russian-offensive- campaign-assessment-april-30-2025

15,313 posted on 05/01/2025 2:56:56 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)

To: AdmSmith; PIF; FtrPilot

The Ukraine minerals deal is signed, and it’s a new deal for Russia.

Kyiv Independent reports:

“At least 72 U.S. senators are prepared to vote for “bone-crushing” sanctions against Russia and massive tariffs on countries supporting Moscow, Republican Senator Lindsey Graham told reporters, in comments reported by Bloomberg on May 1.

The bill would impose new penalties on Russia and slap 500% tariffs on imports from countries that buy Russian oil, petroleum products, natural gas, or uranium if President Vladimir Putin avoids serious peace negotiations to end the war against Ukraine.”

The war won’t continue long, if that is enacted.

15,314 posted on 05/01/2025 2:59:36 AM PDT by BeauBo

Day 1,162 of the Russian invasion. 1,230 [average is 820/day], i.e. more than 51 Russians and Norks/h. Vehicles and fuel tanks more than 245% and artillery more than 90% above average. Motorcycles not counted yet.


15,315 posted on 05/01/2025 3:02:07 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)

To: BeauBo; PIF; FtrPilot
Кремлевская табакерка

Where are our tanks?

Another “sensation” has appeared in the Western media - The Wall Street Journal has published satellite images that can be perceived as Russia preparing for war with some NATO countries. In particular, it is about the construction of military bases and a railway network near the border with Finland and Norway.

But, curiously, the text raised the issue of the absence of new Russian tanks at the front. We have written about this many times, recalling, in particular, the words of the head of Rostec Chemezov that the flagship tank “Armata” is too expensive for use at the front. The media write that now Russia allegedly produces almost 300 other tanks per year - T-90M Proryv. That is, almost one tank per day, which, alas, is not true. Although production has increased. However, these tanks do not often get to the front. And this means that our guys have to go on the attack without cover. The equipment is allegedly stored somewhere inside Russia. And this is a problem, since tanks gradually become unusable without use. Even new ones. Meanwhile, the guys are dying.

The second important point is that if the Armata tanks are too expensive for a war against Ukraine, then will they become cheaper in the case of a war with, say, Finland? Or will there be significantly more Proryvs? NATO countries currently do not have such a quantity and experience in the combat use of FPV drones. This is the main reason why new tanks are not sent to the front lines. But what if the situation changes?

By the way, we wrote about the very possibility of a clash with Finland a year and a half ago. During this time, certain steps have indeed been taken, but this does not mean that it is worth shouting about. In general, sources do not name the exact number of tanks in Russia now, but they specify that most of the equipment now is repaired Soviet models. And not only from Russia, but also from other countries.

https://t.me/kremlin_secrets/56 06

15,316 posted on 05/01/2025 3:10:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)

To: AdmSmith

“Senior Russian officials continue to demand”…

That BS will be coming to an end shortly, and they will start singing a new song.

The Ukraine minerals deal is signed, and it is time to wrap this war up, and get back to business.

Or else. (Bone crushing sanctions on Russia, producing financial collapse.)

15,317 posted on 05/01/2025 3:12:15 AM PDT by BeauBo

To: BeauBo

A likely development.

15,318 posted on 05/01/2025 3:15:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)

To: BeauBo
Russian Telegram:

Hedgehog
Russian troops took control of more Ukrainian territory in April 2025 than in March - 175 square kilometers versus 133. Such data is provided by the Ukrainian military public Deep State. However, the calculation does not take into account territorial advances…

Just to understand the scale of the “success” - the area of ​​Moscow is 2,511 sq. km. In general, the Russian Federation is the largest country in the world by territory. Its total area is 17,125,191 sq. km. At the same time, the Russian Federation also ranks first in the world in terms of undeveloped territories - more than 15 million sq. km. We suggest considering the question of why we needed new territories in Ukraine, and at such a huge price, rhetorical.

https://t.me/moscow_laundry/274 25

The answer can be found in the strange philosophical theories of the Kremlin

15,319 posted on 05/01/2025 3:21:10 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)

To: AdmSmith

“the question of why we needed new territories in Ukraine, and at such a huge price”

Because of Putin.

A million Russian casualties. Cities destroyed. The economic prospects of a generation squandered. Individual freedom sacrificed.

All because of Putin.

15,320 posted on 05/01/2025 3:56:21 AM PDT by BeauBo

To: BeauBo

“ All because of Putin.”

The simplest answer is often the correct one.

Let’s assume he did believe that this would be a short operation and he would have his dreams realized, but since it went off the rails his SVO has taken on a new urgency. His existence.

The Soviet war against Nazi germany lasted just under 4 years. This war is now over three years and has resulted in nothing short of a disaster for Russia and the Russian people

15,321 posted on 05/01/2025 4:29:11 AM PDT by blitz128

To: BeauBo
🇩🇪 🇺🇸 Rheinmetall & Lockheed Martin are expanding cooperation to boost missile production in Europe.

They plan to build a European center of excellence for missile systems— strengthening NATO, EU defense, and reducing reliance on U.S. supply chains.

https://x.co m/NOELreports/status/1917912022890807741


15,322 posted on 05/01/2025 5:26:29 AM PDT by FtrPilot

To: PIF; ETCM
Just after the signing of the mineral deal, Trump administration approves first $50M arms sale to Ukraine through direct commercial sales (DCS).

The move signals continued U.S. support despite calls for a diplomatic solution to the conflict.

https://x.co m/NOELreports/status/1917837079448256697

Direct commercial sales must comply with ITAR...I wonder if Congress has to approve.

15,323 posted on 05/01/2025 5:53:57 AM PDT by FtrPilot

To: BeauBo
🚨 DONE DEAL: The US and Ukraine have signed a deal granting the US privileged access to Ukraine's natural resources, including aluminum, graphite, oil, and natural gas.

This agreement aims to solidify Trump's support in ceasefire talks with Russia.

https://x.co m/NOELreports/status/1917696628825244133

"...oil, and natural gas."

Bad news for ruzzia's petroleum industry.

Pipelines to Europe are already in place.

This will guarantee that Ukraine will eventually become part of the EU.

15,324 posted on 05/01/2025 6:05:42 AM PDT by FtrPilot

To: PIF
Who needs armoured personnel carriers when you have this?

https:// x.com/bayraktar_1love/status/1917583476271759462


15,325 posted on 05/01/2025 6:12:43 AM PDT by FtrPilot

To: blitz128
Russian soldier was very busy beating up his comrade and was so carried away by the process that he did not notice how he himself became a target for the drone.

https:// x.com/bayraktar_1love/status/1917666846041690219


15,326 posted on 05/01/2025 6:56:12 AM PDT by FtrPilot

To: FtrPilot

But I hear Russian GDP is waaaayyyy up 😎

15,327 posted on 05/01/2025 8:20:36 AM PDT by blitz128

To: blitz128

Covert Cabal: What Remains of the Centuries Old Omsk Arsenal (94th)

https://www.youtube.com/watch?v=iUbrWvCs3M8
6 min video

15,328 posted on 05/01/2025 9:22:03 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)


Navigation: use the links below to view more comments.
first previous 1-50 ... 15,151-15,200, 15,201-15,250, 15,251-15,300, 15,301-15,328 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson

15,329 posted on 05/01/2025 10:31:03 AM PDT by JonPreston ( ✌ ☮️ )


To: mir

15,330 posted on 05/01/2025 10:35:34 AM PDT by JonPreston ( ✌ ☮️ )


To: AdmSmith

As of April 30th 2025, the Omsk Arsenal, the 94th, which once held over 60% of all SPGs has been reduced to the following counts:

At the start of the war
2021 ——> 2025

2S1: 920 ——> 459
2S3: 338 ——> 210
2S4: 397 ——> 142
2S5: 421 ——> 205
2S7: 216 ——> 34
2S9: 200 ——> 146
2S19: 2 ——> 0
Totals: 2494 ——> 1196

Mortars: 1655 ——> 70
Towed: 74 ——> 18


15,331 posted on 05/01/2025 11:14:11 AM PDT by PIF (They came for me and mine ... now its your turn)


To: BeauBo; JR

Poster JonPreston continues his harassment of this thread with his post at:
15,329 posted on 5/1/2025, 12:31:03 PM by JonPreston ( ✌ ☮️ )

This distracting and deliberate harassment should not be tolerated.


15,332 posted on 05/01/2025 11:25:40 AM PDT by PIF (They came for me and mine ... now its your turn)


To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/ videos

The complete transcript.

[ Offensive Collapsed! Russian Operation Suffers a Complete Meltdown! ]

Today [ Apr 30, 8 pm ], there is interesting news from the Pokrovsk direction. Here, Ukrainian counterattacks pushed the Russians out of several key positions, endangering their whole operation to encircle Pokrovsk. As a result, the Russians were forced to completely abandon their attempts to take the town, started retreating, and changed their goal to achieve political victory, without any strategic value instead.

After advancing to Pokrovsk, Russian forces set their sights on encircling the city from the west, to sever its vital logistical lines, and forcing Ukrainian defenders to abandon it under threat of encirclement. The Russians hoped to avoid the brutal urban battles that had previously drained their forces in Bakhmut and now at Toretsk. The idea was to isolate Pokrovsk without having to storm it directly and achieve at least a less costly victory.

However, this plan soon fell apart. Ukrainian forces first managed to halt the Russian advance westward, and then began a series of aggressive counterattacks to reclaim key positions. Ukrainian tactics were highly mobile and adaptive, using “thunder runs” with swift, small- unit assaults, designed to shock and disorient entrenched Russian forces. One of the first major blows was dealt at Kotlyne, where Ukrainians executed rapid attacks to disrupt the Russian presence in the village and its surrounding industrial zone. They successfully isolated Russian troops holding these areas, forcing them to abandon positions under relentless Ukrainian drone strikes and artillery harassment.

The breakthrough at Kotlyne allowed Ukrainian forces to expand their operations under the new command of General Major Mykhailo Drapatyi, who had previously orchestrated successes during the Kharkiv and Kherson counteroffensives.

The Ukrainians shifted focus to crippling Russian logistics by systematically disrupting supply lines, and, as dozens of roads in this sector quickly became littered with destroyed vehicles and manpower, Ukrainians made it nearly impossible for Russian units to receive reinforcements, food, or even water, as Russian troops resorted to using horses and donkeys to deliver basic supplies.

Exploiting this and their superiority in drone warfare, Ukraine pushed forward and retook critical positions around Uspenivka, Udachne, Pischane, Shevchenko, Dachenske, and Lysivka, driving Russian forces back from the outskirts of Pokrovsk.

The result of these Ukrainian counterattacks has been decisive, as Russian activity on the western flank has notably decreased. Initially, Russians sent constant streams of infantry through the salient, trying to force the Ukrainians back and prevent their further advance. However, as this suicidal strategy quickly resulted in thousands of unnecessary losses, intelligence reports indicate that Russian commanders have now completely abandoned serious offensive assaults on the Western flank of Pokrovsk.

Whether this pullback is a stepping stone to a larger withdrawal or merely a reaction to staggering losses remains to be seen. Nevertheless, the massive reduction in assaults reflects the severe attrition Russian forces have suffered without achieving their primary objective at all. Facing mounting casualties and dwindling reserves, Russia has now shifted its focus southward. Their new goal appears twofold.

Firstly, to broaden their western pincer by advancing through the open fields south of Pokrovsk, Russians hope to secure better logistics and staging grounds.

Secondly, Russians aim to achieve a symbolic advance toward the border of the Dnipro region, framing it as a political victory in the information war. These southern fields, however, are far less strategically important than the encirclement of Pokrovsk would have been. Capturing them would neither collapse Ukrainian defenses nor threaten the broader Ukrainian logistical network in the Donetsk region.

Comparing Russia’s initial ambitions to its current objectives highlights the scale of their failure. Initially aiming to sever Pokrovsk and score a major operational victory, they are now scrambling to gain marginal ground over open terrain that offers little immediate advantage. Furthermore, the enormous losses of manpower and equipment inflicted by Ukraine, during the defense and counteroffensive west of Pokrovsk, has left Russian forces weakened. Even if they achieve minor gains in the south, their ability to mount another serious push toward Pokrovsk is highly questionable given their depleted strength.

Overall, the Russian attempt to encircle Pakovsk has collapsed under the weight of effective Ukrainian counterattacks and relentless pressure. They are now forced to abandon their grandiose plans. Russian forces now chase much less ambitious objectives, capturing largely empty fields, without any strategic value.

Ukraine’s tenacity and tactical ingenuity around Pakovsk have not only blunted a key Russian offensive, but have forced the Russian command into a reactive weakened posture that could have long-term consequences for their wider campaign plans in Donetsk.

https://www.youtube.com/watch?v=0BE3Js7yh4E


15,333 posted on 05/01/2025 11:50:30 AM PDT by PIF (They came for me and mine ... now its your turn)

(26 images)

Post Comment   Private Reply   Ignore Thread  


TopPage UpFull ThreadPage DownBottom/Latest

#1. To: Vinny (#0)

"15,333" comments posted...to one thread.

And I don't recognize one Screen Name from the olden days. Is FR.com still reliably "neoconservative"?

Regards...MUD

"NOW...Devolve Power Outta the Federal Leviathan!!"

Mudboy Slim  posted on  2025-05-03   11:08:03 ET  Reply   Trace   Private Reply  


#2. To: Mudboy Slim (#1)

Revmom

Williams

The worsT

Love
boris

If you ... don'T use exclamaTion poinTs --- you should'T be Typeing ! Commas - semicolons - quesTion marks are for girlie boys !

BorisY  posted on  2025-05-03   13:02:49 ET  Reply   Trace   Private Reply  


#3. To: Mudboy Slim, BorisY (#1)

Not quite as Neocon as it was during the daBush WMD witch hunt, but there is still a cadre of war mongers supported by management. Revmom and Williams are globalist flacks. I'll be adding to this thread as duty calls.

Vinny  posted on  2025-05-03   14:22:59 ET  Reply   Trace   Private Reply  


#4. To: All (#3)

Don’t fool yourselves — there will be no tomorrow if Ukraine attacks the Victory Parade.

Vinny  posted on  2025-05-03   14:49:04 ET  Reply   Trace   Private Reply  


#5. To: Vinny (#4)

: UMCRevMom@aol.com

Hugs to you, my friend. You are running the race, you are fighting the good fight.

Megan

193 posted on 1/20/2025, by MeganC (❤️❤️❤️❤️❤️ ❤️❤️)

LasT posT

Meganc

Love
boris

If you ... don'T use exclamaTion poinTs --- you should'T be Typeing ! Commas - semicolons - quesTion marks are for girlie boys !

BorisY  posted on  2025-05-03   18:24:35 ET  Reply   Trace   Private Reply  


#6. To: Vinny (#3)

"...daBush WMD witch hunt..."

FWIW...Iraq transported their WMDs to Syria as the U.S. publicly debated whether or not Iraq had them.

"NOW...Devolve Power Outta the Federal Leviathan!!"

Mudboy Slim  posted on  2025-05-04   6:47:57 ET  Reply   Trace   Private Reply  


#7. To: Mudboy Slim (#6)

Iraq transported their WMDs to Syria

I believe that to be CIA endorsed, post-debacle, Bush/Neocon speculation. I believe nearly nothing our government says in regard to war. A recent glance at our corrupt intel agencies and their compliant media lap dogs, has largely proven me right.

Vinny  posted on  2025-05-04   9:49:25 ET  Reply   Trace   Private Reply  


#8. To: All (#4)

Vinny  posted on  2025-05-04   9:53:20 ET  Reply   Trace   Private Reply  


#9. To: All (#8)

Massive False Flag potential

Vinny  posted on  2025-05-04   9:57:19 ET  Reply   Trace   Private Reply  


#10. To: Vinny (#7)

Unfortunately, the Deep State's demonstrated seditious behavior during Trump's first term makes it impossible for me to contradict your conclusion. America's corrupt Intel agencies are perfectly capable of committing rampant treason...MUD

"NOW...Devolve Power Outta the Federal Leviathan!!"

Mudboy Slim  posted on  2025-05-04   17:43:23 ET  Reply   Trace   Private Reply  


#11. To: (#10)

Build a wall, isolate and protect American citizens from the ongoing attack on our culture and society.

Vinny  posted on  2025-05-05   9:49:01 ET  Reply   Trace   Private Reply  


#12. To: All (#11)

REVEALED: Elite Pedophiles Paying $150K For Ukrainian Children at ‘Sweet Shop’ On Border

Ukrainian babies and very young children are being kidnapped and sold at the Ukraine-Poland border where elite pedophiles are paying up to USD $150,000 to purchase the infants for their own deranged pleasure.

This is just a sweet shop for them at the moment,” says Dean, a former British soldier who is astonished at the world of elite pedophilia he has encountered. Dean now works for MitMark, a private risk advisory company that ‘fell into’ trying to combat human trafficking after arriving near the Medyka crossing in Poland to embark on crisis management projects.

You wouldn’t think that any human could do that to another human,” he said. “It’s beyond terrorism. I’ve fought against terrorism most of my adult life but at least they believe in something. Traffickers don’t believe in anything but greed and money. Life means nothing to them.

Byline Times bylinetimes.com/2022/05/06/inside- the-fight-against-the-human-trafficking-sweet-shop-on-ukraines- border/">reports: The going rate for a baby or very young child – either to be sold into sexual slavery or killed and harvested for organs – is around USD $150,000.

Exploiting a Crisis

Since the Russian invasion of Ukraine began on 24 February, around 5.5 million Ukrainians have fled abroad. The vast majority of them are women and children, as men aged 18 to 60 are forbidden from leaving the country under emergency laws.

The journeys are arduous, often spanning thousands of miles and several days, and often preceded by weeks lived under Russian bombardment and occupation.

Those who arrive abroad are exhausted and overwhelmed by the help on offer on the Polish side of the border from the huge volunteer movement that has mobilized. Here, they feel that they can relax and finally let their guard down a little.

But the best camouflage for a human trafficker is the kindness of others.

We had one Italian guy who pretended to be a volunteer who took a whole family of women and kids, seven people I think, and told them he would drive them to Italy,” said a volunteer who wished to remain anonymous.

He drove them to Italy then in the middle of nowhere he told them to get out. They got out and he drove away. I think that maybe he was told on the phone that the police were onto him and he just got rid of them. He also took another woman and kid and we still don’t know where they are.”

No one knows how many people have been trafficked since the Russian invasion began, only that it is happening and it is organized on a professional level.

Most trafficking in Poland happens through organized crime networks in the central European region and it was a problem long before the refugee crisis itself,” says Allison Byrd, special projects coordinator at anti- trafficking charity Unbound.

It’s helpful to remember this is a situation of supply and demand. So where demand is high, we know the supply is going to reach that. And sadly I’ve heard reports from some of our partners that searches online for Ukrainian women have skyrocketed. So traffickers are highly motivated financially to meet that demand.

On the ground at border crossings, gang lookouts – or ‘dickers’ – prowl the area, taking photos of women and children which they send to the higher-ups who then decide if they are suitable for trafficking. It is these dickers that Dean and his colleagues are on the lookout for.

It’s not difficult, to be honest, because if you’re a male between the age of 19 and 65 and you’ve not got documentation to say you can’t fight, and you’re not Polish, then what are you doing there and lurking about?” says Dean.

He points to a photo on his phone of a Caucasian male. “We’ve got eight of these on file,” he explains. “This guy I saw on the other side of the border four days ago. Look at him – he’s 40-years-old and doesn’t look unfit. What’s he doing there? He’s not scruffy, has a fresh haircut and he’s talking to young people with kids.

Facial recognition technology can also help to detect in real-time people known to work with criminal gangs, something that has been deployed by Unbound to good effect.

After spotting a woman claiming to be a volunteer but offering to pay refugees to carry bags over the border for her in exchange for a lift to Warsaw, a team member discreetly photographed her and sent it to a colleague in the US. “He ran the photo and he confirmed that this person is connected to people who are not good people,” says Byrd. 

The surveillance undertaken by MitMark and Unbound has proven effective, with Dean’s colleagues managing to intervene in two cases where people were about to be trafficked.

Speaking of one of these interceptions, he said: “We stopped this, the guys went in there, got the lady and two young children into a safe haven where there’s a crisis management team. We tried to grab the guy but he’d bolted. We gave the surveillance we’d collected on him from previous days to the Polish police but they didn’t really want to know.”

The incident highlights one of the main issues facing those trying to combat trafficking – the reported reluctance of authorities at the border to do anything more than the bare minimum of keeping the area calm and quiet.

“I’m from Kyiv and I arrived in Krakow train station on the 5 March with my three-year-old child and my friend and her two children,” a Ukrainian woman who wished to remain anonymous told Byline Times. “One guy came up to her out of nowhere and said ‘hello, where are you going? I will drive you to a safe place. I’m here to help’. I was running over to her with the kids and telling him to f*ck off and he ran away.

As the course of the war shifts, so does the flow of refugees. Many Ukrainians are now heading home, reassured that because of Russia’s failed attempt to take the capital of Kyiv, it is now relatively safe to do so.

Inevitably, the traffickers now see opportunities on the Ukrainian side of the border, targeting people as they enter their home country and look for ways to travel to their hometowns.

We were [on the Ukrainian side of the border] the other day and there were Mercedes cars with blacked out windows full of guys,” says Dean. “It seems like something out of a movie but it’s true – two big saloon cars, three guys in each car which makes no sense. If you were there to pick somebody up to take them back to Kyiv, for example, you wouldn’t have three guys in each car. There are red flags everywhere.”

(Article by Baxter Dmitry

Vinny  posted on  2025-05-05   10:26:53 ET  Reply   Trace   Private Reply  


#13. To: Vinny (#12)

You would hope this was misinformation, but it seems these pedophiles are almost universal within the Effete Elite class throughout the planet. From Puff Diddy to Epstein to those freaky immigrant Pedos in England to the Catholic Church, these wealthy In-breds are determined to rape and enslave powerless children.

Absolutely disgusting...MUD

"NOW...Devolve Power Outta the Federal Leviathan!!"

Mudboy Slim  posted on  2025-05-06   9:18:10 ET  Reply   Trace   Private Reply  


#14. To: Vinny (#12)

As I was saying...

Yuck...MUD

"NOW...Devolve Power Outta the Federal Leviathan!!"

Mudboy Slim  posted on  2025-05-06   9:35:35 ET  (1 image) Reply   Trace   Private Reply  


#15. To: All (#14)

Double-YUCK...MUD

"NOW...Devolve Power Outta the Federal Leviathan!!"

Mudboy Slim  posted on  2025-05-06   9:40:10 ET  (1 image) Reply   Trace   Private Reply  


#16. To: All (#15)

Word...MUD

"NOW...Devolve Power Outta the Federal Leviathan!!"

Mudboy Slim  posted on  2025-05-06   10:01:02 ET  (1 image) Reply   Trace   Private Reply  


#17. To: All (#16)


Do Marxists and Pedophilia ALWAYS go hand in hand?!

Seriously...MUD

"NOW...Devolve Power Outta the Federal Leviathan!!"

Mudboy Slim  posted on  2025-05-07   9:26:16 ET  (1 image) Reply   Trace   Private Reply  


#18. To: Mudboy Slim (#15)

That guy looks freaky. Like a sex pervert. You can see it in his eyes and his strange "smile".

Has the appearance of a pedophile.

A K A Stone  posted on  2025-05-08   8:09:39 ET  Reply   Trace   Private Reply  


#19. To: Vinny (#11)

We should destroy the Houthis. They attack our ships.

Muslims are our enemy too. We should start by deporting all the muslims that are here. You can't be a U.S. Citizen and a Muslim too.

A K A Stone  posted on  2025-05-08   8:11:32 ET  Reply   Trace   Private Reply  


#20. To: A K A Stone (#18)

If only they were so readily-identifiable...
Lotta weirdos out there these days...MUD

"NOW...Devolve Power Outta the Federal Leviathan!!"

Mudboy Slim  posted on  2025-05-08   9:18:57 ET  Reply   Trace   Private Reply  


#21. To: All (#20)

"The A.N.S.W.E.R."

"FReepers!!"
(To be sung to Lynyrd Skynyrd's "Free Bird")

RATZ will steal, beg, or borrow...
To defend JOEZ Tyranny!!
But JOE must be travellin' on now...
'Cuz his Treason threatens our Liberty!!
If we condoned State Corruption...
Country wouldn't be the same!!
Righteous must retake control, now...
DeeCeeSwamp, we shall then DRAIN...oh-oh-oh-ah-oh-ohhhh...
Next, DemRATZ shall feel our ra-a-a-age...
Marxists, bow yer heads in sha-a-a-a-a-ame...
Lord knows, World's gonna cha-a-a-ange....

[Guitar weepin']

Realize, Biden, you'll go to prison...yeah, yeah...
You're just a Tyrant, you can't change!!
Oh, please don't act like the Victim...
'Cuz Lord knows you're to blame.
JOE, if we condoned your crimes, boy...
Nation wouldn't be the same!!
So we FRee-eep fer the Truth now...
And RATZ World we shall next change...
Oh-oh-oh-oh-oh-ahhhh...
Dem Marxists we'll now de-Fame...
Fake News Media shall be shamed!!!
Lord knows it shall change...
Lord, help us, we must cha-a-a-a-a-ange...
Folks, we must change...
Won't ya join WeThePeople?!! Yeah-eah-eah!!

[Guitar Jammin' to close]

Mudboy Slim

2 posted on 9/11/2002, 9:17:05 AM by Mudboy Slim

Updated today...MUD

Mudboy Slim posted on 2022-08-10 17:15:53 ET

"NOW...Devolve Power Outta the Federal Leviathan!!"

Mudboy Slim  posted on  2025-05-08   10:10:17 ET  Reply   Trace   Private Reply  


#22. To: All (#21)

BTTT...MUD

"NOW...Devolve Power Outta the Federal Leviathan!!"

Mudboy Slim  posted on  2025-06-13   9:14:49 ET  Reply   Trace   Private Reply  


TopPage UpFull ThreadPage DownBottom/Latest

[Home]  [Headlines]  [Latest Articles]  [Latest Comments]  [Post]  [Mail]  [Sign-in]  [Setup]  [Help]  [Register] 

Please report web page problems, questions and comments to webmaster@libertysflame.com